EST 1478588 is a singleton


Sequence

>1478588 (1 EST) Length=283 CACAATAACAAATGTATTGATGTATACAAATTAAGAAAAAACATTACAACCTGTGGACCAATACAACGTTACAGGCTTAG ATAAGCAAAATAAATAAGAAATATAATTAGGTAGGTCTTTAGTAAAAACATCAACACAATCAAATTTACAACTGTTAAAG GTTCACACAAATTAGATAAGATACTATTGATTTCTGTCAAAGGCCAAGTACACTCATGAACAGCTATCAAAGAAGTAACA CTCAACCTCTTTTGANTTGTTTTGATGACATCTAAAAGGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478588: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785882804084AA756914MF4MA156.AF3S. mansoni female adult Lambda Zap


Date: 14:15:12 on Sat 18 Nov 117.