EST 1478590 is a singleton


Sequence

>1478590 (1 EST) Length=337 AAAACGTTGGATTTGTCTTCACTAATGGCGACCTTACAGATATTCGTGAAAAAATTTTGAAAAACCGTGTCGAGGCACCA GCTAAAGCCGGTGCAGTCGCTCCATGTGATGTCATCGTGCCAGCGCAAAACACTGGTCTAGGTCCAGAGAAGACAGCTTT TTTCCAAGCTCTTAGCATACCGACAAAAATTGCTAGGGGAGCAATTGAAATTATTAATGACGTCCATCTGGTGCGCAAAG ATGAAAAAGTCGGGATGAGCGAAGTACACTACTTGGAATGTTGAAAATTCATCCATTCACTTATGGTTTAGTCATCAAAC AGGTGAAAGAACAGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478590: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785902804086AA756916MF4MA158.AF3S. mansoni female adult Lambda Zap


Date: 21:15:57 on Fri 24 Nov 117.