EST 1478591 is a singleton


Sequence

>1478591 (1 EST) Length=251 GTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCATTCCAAAATAAATTTTATTTGGATTCGTCATTTTTTATGTTATTTG TACAATCACATTTAGGTGATGGTGAGCAAACTTCTGCTACATTGTATTTACGATATTTGAAGAAATTTTCCAACAAACTG ACACAAGTCACCNNACACAGAACAGTTATTGAGACAACAACTGAAGGCGATGAATTCGATATATTCCAAGATGAATCAAC TGATTTGATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785912804087AA756917MF4MA159.AF3S. mansoni female adult Lambda Zap


Date: 16:4:41 on Fri 17 Nov 117.