EST 1478593 is a singleton


Sequence

>1478593 (1 EST) Length=356 AGTTATTATTTACTTAATTCATTTTACAATTGAATTTCTCACAGTCATTGAATGAGCATCCTATTGTGTTGTTTTTTAAA TGTTTTGCATATATTCGTAAGTGCCTTCTCGCAAGANCAGGAAGCAGCTACTTTTTGTTGAACTGGAAGATACAATTTGA ATTCTGGGGGTAGTTCGCTTTCTGAATACAAACGATCACAAAAGTAAACTCTGCGTATGCGACAGTTGGCATGAATTTCG TACTCTCAGCGTTTCAACGTAATTAGTTCCGTAGCACGTCTTGTGAAGTCACAAAGATTAAATTGAATTTGGTTCCATCC TTCATCTAAGCGCATTGGCATGGTACAAATAAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478593: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785932804089AA756919MF4MA161.AF3S. mansoni female adult Lambda Zap


Date: 6:11:53 on Wed 22 Nov 117.