EST 1478594 is a singleton


Sequence

>1478594 (1 EST) Length=303 TAGATGAATAATTAAAAAAAAGCAACNTATTTTGATTCTTTGAATTACATCAAGTAGTGTTATTTTGCGTTTACGTCACG GGATCGCATATCCAACTCAACCTCTTTTAATGAATCGTCATCATTATTGTCATCACCATAACTGTAATCAATAGGGATTC ATTTATCCTTACTCTCTTTCTATGCCTTATTCTTTCCCTCCCTCTCTTTCTTTTTGTCTCNTATTCTCTGTGGACTTCAG CTATAAGTTTTGTATTGCTTAAAATAAACCAAAATGATAATAATATTACTTATTATTGTCGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478594: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785942804090AA756920MF4MA162.AF3S. mansoni female adult Lambda Zap


Date: 13:22:16 on Wed 22 Nov 117.