EST 1478595 is a singleton


Sequence

>1478595 (1 EST) Length=335 CAAAGAAAATCAGAGCTTCNTCATAGTCAAACTACTATTCGTGCACTTGAACAACATCGTCGTCCAGATGAATACTTAAA AACTCAACCTGACAGCTAAGGTTTACAGGATTTTTTTCTTCAAAATATTAATTATTAGCTAAGTATCCCGGTCTCAGCAG GTTTCTGACACACACACACATATATGTGTGAATGTAAAAAAATACAAACNTATGGTATAGTATAATGCTTCATTCTTTTT CCCCATAGATGTAGCTTACTGTTGAGATGTCCATTTCTCTGAAACTGTTCAATGTTAACTATCGAGTTCAATCAGTTTAT CTCGTTGTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1478595: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785952804091AA756921MF4MA163.AF3S. mansoni female adult Lambda Zap


Date: 2:52:12 on Mon 20 Nov 117.