EST 1478599 is a singleton


Sequence

>1478599 (1 EST) Length=282 CCTAATCGTTGGTTACCTCGACGAGAACGTACTCACTATCGTGGCAAACGTCGTGACAAGCGATTTGCTCNTACAAGTGG GTCCTAGGGTCAAATAACTGAGAGAGTGAATGGGATGCTGCTATACGTAGTCCTAAAGTCAAAATTCCTGAAGACGGTTC AGCAGGATCTACTCNTAAACAAATGTCTAATACAGCTAAACAGCAACAAAAGAAAGGTCGTAAGAAAGGCCGATAATATC ATCAAAAATAAACAAAACAAAACATAAGTCCAATTAATCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785992804095AA756925MF4MA167.AF3S. mansoni female adult Lambda Zap


Date: 11:55:46 on Thu 23 Nov 117.