EST 1478600 is a singleton


Sequence

>1478600 (1 EST) Length=354 GTAGAACTTCTAAACCATTTGAATTAAATACGCCAATTGTTGAGGATAAGTTTACTATAGATGTGACAAATGATGTTAAT GTTGATGAGGATACTGTTAATGTACAAAGAAATCCTGTTACTACTACGACGACGACGATTATCACTACTGCTACTAGCTC CACTACTACAACTACTTCTGGTACTGGTACTACAAACAGCACAACACCAACTAGTACAAATGAAGATAACAATGATGCTA ATCTTGAGTCACACTCTTGGTAGCGGTAGTGGTAGTAATAATAATAACCATAAAAAAAGATACTAACAGAGAACAAACTA ATAACGATAACAACACTAATTAAACACTATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14786002804096AA756926MF4MA168.AF3S. mansoni female adult Lambda Zap


Date: 22:59:59 on Wed 22 Nov 117.