EST 1478601 is a singleton


Sequence

>1478601 (1 EST) Length=363 GATGGGCTCNCACTTGCAGCAACTATTCAAGATGACGAACAGCTAAATCGTGAAATATTCCAGTATCAAAATCAAGCAAA AGCACTCGAAAGTCGTATGACTCNTACTTCTCCTTCTAGATGTCTCTCCATTGCTGGTCCTTACGGTGGGCATTATCTGC TAGATCGTGGTGTTTGCTACATTATTCTTACAGACTCACAGTTCAGTCGTACAAAAGCCTTTGCATTTTTAGAGGCCATA CAAACAGAATTTTACGGCAAATACTACCAACAAATACAAACAGTTTCAAGACCTTACGCATTTCTTGATTTTGATCACAT TATACACAAAACTCAAAAAATCTATAGTGATAGTCGGTCATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1478601: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14786012804097AA756927MF4MA169.AF3S. mansoni female adult Lambda Zap


Date: 17:13:28 on Wed 22 Nov 117.