EST 1478660 is a singleton


Sequence

>1478660 (1 EST) Length=326 TTTGCATCGCCATGTGTGGTTGANAAAACTGAACTCCTCTCTTGTTTTGGCCATACGAAACACCCATTCCACAAGCGGTC GTGANTCNGTGCCACAGCCAACCGCGGTGCCGACGCAGAAGCCGCACCCGTAGCTCAAAGGGCACCTGACTGCTCTTATC GGGAATTTGAATGGCACGAGCAGCCTCAACAGCCGTGTGCAGCGANGGCAAGAACACTCGGTTTGTGCTTTGAGCGCGAC ACATACGTCACATTCCCCAACAGCATGCTCGAGNTTCTCCACCGGACGCACATACGCCTCATCGTCCGTGATGGAATCCT TACCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1478660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14786602804507AA756986TENU0049T.cruzi epimastigote normalized cDNA Library


Date: 14:3:10 on Mon 20 Nov 117.