EST 1478666 is a singleton


Sequence

>1478666 (1 EST) Length=294 GTTGCGCTTCCGCCCGTGCGGCCACATCCTTGGAGGCTAGAAAGTCGCCGCAACCAGAGTCCACCCTATCCCCGGACAGT GCTGGATGCTTCGTGACGCCTGGAGACACCGATGTATCCGATAAAAAAAGTGCGAACCCCGAATTGGCGTTGCAGGGCAC ACCCGTGCATTTGCCTGTCGAGTTGGAGGGCGGCTCTGCGCCCAGAGACGATGAGTGCTCAACGGTGGAGCGTCACGCAT TGCAGAACACACCCTTGCAAGACCCAACATTAGCGCCTTGTCAAACCAACGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1478666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14786662804513AA756992TENU0055T.cruzi epimastigote normalized cDNA Library


Date: 4:10:9 on Wed 22 Nov 117.