EST 1496055 is a singleton


Sequence

>1496055 (1 EST) Length=244 CATCTAGATTTTAGATCATTAAATACGATACATTTTAAGTCCGATGAAGCATTACACTTTATTAATATATAATATAACAC ATTAGGACAATGTACACGTTCATTTTGGTGCTTTCATTATCACTATTATTATTCTTATTAGTGTAATTCATTTTAATATC CATTCAATTTTCTATTGATAACTCATTCATTTACCTGATATCTAACTGATCAAGTCATATATTATACTTTGAGCTCATGC ATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1496055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14960552833716AA774380SMTBADA000716SKSchistosoma Lambda Zap II


Date: 11:3:9 on Tue 21 Nov 117.