EST 1513000 is a singleton


Sequence

>1513000 (1 EST) Length=239 GTCGGCGCACAGCAATACTGCAAAGACGGCAACCGAAAGAAATGGGAGGAGGGGCCCATAGGGGATGAGTGAGAGAGAGG GAGGGAGATGAAAGAACCATGAAGGGGACCGGAACAAATTTTTGCATTGTGAGTGTAAAAGTGAGAGAGAACCCATCAGG ACGAAGAAAATGAAAAAGGAAGGACGACGGAGGCTAGTATACATATGACCAGGTACGGTGCACGAGATGAGGGAGAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513000: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130002854280AA791325SMTBADA000727SKSchistosoma Lambda Zap II


Date: 11:49:17 on Fri 24 Nov 117.