EST 1513002 is a singleton


Sequence

>1513002 (1 EST) Length=208 GAGAAACATGGTAAAAAGTCACGATCCATGCGTGCTGGTCTTCAGAACCATGTAGGAGCAGTTCACAGACTATTGCGCAA TGGAAACTACAGTGAGCGTGTTGGTGCAGGTCCCCTGTATACCTTGACAGCTGTAATGGAATACCTAGCTGCTGAAGTGC TTGAACTGCTGAAATACACTCAGGACTACAACCAATCCAGATCCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1513002: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130022854282AA791327SMTBADA000730SKSchistosoma Lambda Zap II


Date: 20:38:36 on Thu 23 Nov 117.