EST 1513004 is a singleton


Sequence

>1513004 (1 EST) Length=284 AGCTAAGCTGTTGCAGATACCTGTTCATCCAGATATCAGAATATTATTTAAGGCCGTCTGTTTGGTTATTGAACAAAAAC TTGAGGTAAATATATTGAATGATGCTATAAAAGCTATGGGACATCTAAAATTGATATGTTAAAGCTCGATGATGTATGTC TTGGATTTAGTGTTAAAGATCCCGTTGTAGAGGCTGCGGCTGTTGCGTTAAGATTGTTAAATATAGATCGGCTACGTAAA TACAAACCAAGCAATGCTAGATAGTCAAAGTTTCAAATTGCGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1513004: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130042854284AA791329SMTBADA000743SKSchistosoma Lambda Zap II


Date: 19:37:11 on Mon 20 Nov 117.