EST 1513005 is a singleton


Sequence

>1513005 (1 EST) Length=203 AGCTAGATTAACGGTATGATTTCTGGTATCTTGCACGAGCTCCGGAGCCACCAAACTTTTTTGGTTCACACCTTCTTGGA TCAGCGACTAACAAGCTTCTATCATACTGAACGAACTTCTCCTTAATCATATGGTTTTGAACATTCATCGAACGTATTTT TTGATGGAATGCTACCACTGACTTAGCAATAGCCTTGCCTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1513005: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130052854285AA791330SMTBADA000744SKSchistosoma Lambda Zap II


Date: 21:8:43 on Fri 24 Nov 117.