EST 1513008 is a singleton


Sequence

>1513008 (1 EST) Length=201 CGTCGTCGTCAGTATTACTGCCAACATCACCAACATCATTACCTATCTCCTCATCAATACCAAATGAAGAAGAAGAAACA CTTCGTTTACAATTAGCATTAGCTTTACAAATTGATTCAGAATTGAATAAAGCAATGAATTAGAAGAATGCTGCTAGTGA ATCAATTCAACAAGCTAATTTATTAATAAGAGCTATGAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1513008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130082854288AA791333SMTBADA000774SKSchistosoma Lambda Zap II


Date: 12:27:42 on Fri 17 Nov 117.