EST 1513009 is a singleton


Sequence

>1513009 (1 EST) Length=252 GTGGGCAGTCTGTAGATGATGCTTTCGCACAATTAGGATTCGTACTGAAAAGGGAGCTAGAATCCTTGAAGAGGTGCTAG AAGAAGCTATTGAGCTAGCAGTTAAGGAGCACGATTTTGAATTCTGTACAAAAATTTGGATAGAGTCAGCACATGTTTCA CGAGGTCGAATGGTTCCATCGTTTATACAAAGGCTTACCATCTGTTGTACATAGTATTAACTTTCACTACACAAATTTAT ATATACGTCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1513009: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130092854289AA791334SMTBADA000776SKSchistosoma Lambda Zap II


Date: 6:16:30 on Wed 22 Nov 117.