EST 1513011 is a singleton


Sequence

>1513011 (1 EST) Length=190 GAGTGGAGTCCCACTTATGATGTACTAGCCATATTGACATCTATTCAGTCTCTTTTGGATGAGCCAAATCCTAACTCCCC AGCTAACAGCATGGCAGCTCAACTTTAGTGGTAAAATAGACGCGAATAGTAGAAACGCGTTGTCGTTGTAGAGGAAAGCT GGATCAAGAAGATGTGTGAAGATAAAGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1513011: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130112854291AA791336SMTBADA000778SKSchistosoma Lambda Zap II


Date: 7:30:58 on Sat 18 Nov 117.