EST 1513015 is a singleton


Sequence

>1513015 (1 EST) Length=260 GAACCAATNTGTAAAAACTTGAAAATATCTAGTTGGCTCCTCACAATCATCCTCCAAAACCTACACATACTATCGATTCA ATGCCGATTTTCACCTTACCCCAGGTTACAGCTCTTTGTGAGCGCTTAATCAAAGAACGCGAACGAGAGTTACGCGAAGA GTATGACAGTATATTATCAAGTAAATTAGCAGAGCAGTATGAAGCATTTCTGAAGTTCAATCATGATCCAACTCTACAGT CGATTTCAGACACCAATGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1513015: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130152854295AA791340SMTBADA000814SKSchistosoma Lambda Zap II


Date: 5:55:16 on Sun 19 Nov 117.