EST 1513018 is a singleton


Sequence

>1513018 (1 EST) Length=270 AATGATGTTTAGTGTTGGGATACTGATACTGTATAACAAACTCTCGTTGGCTTTTACGAAATTATAGGCGTGTATATCTG GATTCGTAAGAACAGATTTACCGACTGACGTGATCATTCCAGTGAACCATTTCACACTGTCCTGTGTAAAGCCTTAGAGA GAGACTCTTTGCTACATAACTTTCACTTTCATTTCTGATTATATAAATACAAGCGATCCGTCATACCTCACTCCGCATTA TATCTTGTCACATTATTGCGATTCAATACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1513018: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130182854298AA791343SMTBADA000827SKSchistosoma Lambda Zap II


Date: 6:22:35 on Fri 24 Nov 117.