EST 1513020 is a singleton


Sequence

>1513020 (1 EST) Length=287 TTATGGAGTAAAAATTTAATTCAAAGAATGGCTTTCAAAATTGATGATTTTACAATCCAAGAAGATCAAGTAAAAGTTGC CAAAGATGTTTTCAAACGTTTTGACAAAAGAGGACAAGAAAAAATTAGCACCACTGATTTAGGTCCAGCTTTTCGTGCAC TTAATCTTACTGTTAAACCCGACACTTTGAAAGAATGGGCTGATCGAGTAGATGACGATGCAACTGGATTCATTGATTTC AATGGATTTCTAATTTGTTATGGAAAGAAACTTCAAGAAGATCAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1513020: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130202854300AA791345SMTBADA000832SKSchistosoma Lambda Zap II


Date: 20:54:6 on Thu 23 Nov 117.