EST 1513021 is a singleton


Sequence

>1513021 (1 EST) Length=228 GGGATGTTAATCTGAATTATAATGTTAACAATATATACCCGTGCAAGATCTCAATCAGAATCTTGATGATAGGTTCTTTA AGANGCCATTAATCACTCAGTGAATAATGGCACTTAACTTTATTTGTATATAGTTAGTGTGCATTTAGTTTAATTAGCAA GTGAACTTACTTTGAGCTATTTCAATGCAATCGCTATTCCTTCTTCTCTTACCTCGAATGTGTTCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1513021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130212854301AA791346SMTBADA000835SKSchistosoma Lambda Zap II


Date: 18:56:58 on Sun 19 Nov 117.