EST 1513024 is a singleton


Sequence

>1513024 (1 EST) Length=313 GAGAGTATAATTAGAATAGACACANNNNAAAGACTACAAAAAATGTGTTTTAAAAATGTATCGGCGATTTAAAACTGAGA AATAAGTAAACTTATATTTCTGCTCACCAATCTAAAATTATATTATAAATTCGTAATAAAGAAAACGTATGATCAATAAA AAAAAAAAAAAAAAACTCGAGGGGGGGCCCGGTACCCAATTCGCCTATAGTGAGTCGTATTACATTCACTGGCGCGTTTA CAACGTCGTGACTGGGAAACCTGGCGTTACCACTATGCTGAGAATCCCTTTGCAGTGGTATACGGAGGCCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513024: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130242854304AA791349SMTBADA000839SKSchistosoma Lambda Zap II


Date: 7:6:8 on Mon 20 Nov 117.