EST 1513025 is a singleton


Sequence

>1513025 (1 EST) Length=372 CCAAATAAATCTAGACGTTATTTAATTTCGAAAAATCTCGGTGATACTTCTTGGTCTACTGATGACTGTAAAAATGCTTG TGACAATTGTCAACGTAAAAGCACAAATAAGTCAGATGTATCTACTCTGATTCAAATAAAAACCAATGAATTACTGAATG CAACAAAACAATTATTATTTGATCAAGTTTAACAAAACAAGAAAGGATTACTGGCCCTAAATTATTGATCTAATGACTGT AATTAAACAAATACAATCAATCAGTCAAAAATTATTCGAATAAAATCAGAAAACTGACGTCATTATGAGCACTTCAACTT GGTTATACTCAATTAATCAAGTTCATTAACCTTACTGTGATGTGAACTGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130252854305AA791350SMTBADA000840SKSchistosoma Lambda Zap II


Date: 7:30:8 on Sun 19 Nov 117.