EST 1513026 is a singleton


Sequence

>1513026 (1 EST) Length=204 GATTTTTGAGTGCGGGAAATTTAAATTTTTTTGATTGATACATTGAATTTAGGAGAATTTATATCTTATCGAACTTTTTT TATTTATGAAACGATAATAAACTTCCGCTAAACAAATTATGTAATCATGAATAAACAAATATATTATCAAGTCTTGAATT AATGTAGTCCACGTACACAATGATGATGACGATATTTATTAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513026: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130262854306AA791351SMTBADA000841SKSchistosoma Lambda Zap II


Date: 12:1:27 on Thu 23 Nov 117.