EST 1513034 is a singleton


Sequence

>1513034 (1 EST) Length=225 ATGTATCATACCAGTATTTGAAGTTTTTCTTGGAAGACGATCAAAAATTAGAACAGATACGTCAGGATTATTCCAGTGGC AAACTGTTGACAGGTGAAATCAAAAAGGAGCTTATCACACTGTTGACTGAGTTTGTTACAGAGCACCAGAGAAAACGAGC TGCGATTACTGATGAAGTTCTCAAGCAATTTATGACTCCTCTCCCACTGCGTCTCCATTATTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1513034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130342854314AA791359SMTBADA000857SKSchistosoma Lambda Zap II


Date: 0:44:7 on Thu 23 Nov 117.