EST 1513039 is a singleton


Sequence

>1513039 (1 EST) Length=276 TACAGCTGAAAATAATCTAATGATATCAGTGGTGGTAGTAGTTCGAGGCCAGTTAATCCAAAAGTATCTGGTTTCAATAC ATCAGAATATTCTAATCATAATCCTCGATATTCAACAGTTAATCCGGCCTCATCTTTAAATATGGCACAAGATGAAAACT CACTCAATATGTTGACATCTTTGTATTGAAGCACTAATCGTTCATTCCATCGTATGAGACGCCGTGAAGTCACTAGTCCT CTCTGCCTACAGACCAGTGATGATTATAGTTCGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1513039: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130392854319AA791364SMTBADA000909SKSchistosoma Lambda Zap II


Date: 23:33:6 on Sat 18 Nov 117.