EST 1513040 is a singleton


Sequence

>1513040 (1 EST) Length=202 AAAGGCTCAAGTCTTATTAACCAAACATGTTTAGTTATCTGTGTATATACGTTGTGCTTCTTCCATTCTCGGTTAATTTC ATTGTGTATTTGTGAATCTTTACACTCTTCAATTTTTTATCGTGTTTACAGTCTTATTTTGTACATAAATTATGCAGTTT TTAAAATGATTTGACAAATTGAAAATAAGCTGTACGTTGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513040: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130402854320AA791365SMTBADA000916SKSchistosoma Lambda Zap II


Date: 0:56:32 on Tue 21 Nov 117.