EST 1513043 is a singleton


Sequence

>1513043 (1 EST) Length=317 GTATCTATATCATCTGTAAATACAATGACCAAATGAGTAAAAAATATTAAAAACAAAACTTGTTCAAGTAAAAAATGATC CTGTAACATAATTTCTTTTTTTTTAGAAAAGATGAAAGACTAATGAAAATGGAAAGTTATCGAAATGTTGTAGGTTTGAA GCCGTCAAGATGTTTTATTATCCCTTTACTGATTTACTTTAGGGTAAATAGATAATAATATTATATACATGTAGTTTTAA AAGAAAGTCATATTATTCTTAGACGACGACAATAGAAGAATGAAATATGCAATAGTGTGCCCGACGAAGCAAGCATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513043: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130432854323AA791368SMTBADA000926SKSchistosoma Lambda Zap II


Date: 17:55:10 on Tue 21 Nov 117.