EST 1513044 is a singleton


Sequence

>1513044 (1 EST) Length=228 AAATACAAACCTGCTTAAGTACCACAAAAATTTAATTAGTTATTGCACCTCGATCTAAATTCCTTTGATTATTTTCTTCT CTCTCTCTCTTTATCTGTGTGTGTATCAGCTTTAAACGTTTACTTCTCTCATAATATTTATTCAAATACGAGTTGCTACT GATGTTATTATTTAATTCCCGTAGAAAGTCAGTATAAGAATCAAAGAAAGAAAAGACCCATTATTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513044: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130442854324AA791369SMTBADA000934SKSchistosoma Lambda Zap II


Date: 2:14:35 on Wed 22 Nov 117.