EST 1513048 is a singleton


Sequence

>1513048 (1 EST) Length=218 CGAGGTCATTCTGGCAATCTGTATGAATGTCTACTAGATCGACGTGAAAAAATGAAATCAGATCGATACTGTATAGTGAT AATTCATCGTGTAATTTTTTTTATCGTCTTTTTACGAAACATGTATTATTTGTTCACTGAAGTGTTGTCGAAATCGTCGA GACAGTTCTCTTGACTACCGGAAGATAATTTATTTTAATGTTTCCTTCTTGTAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1513048: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130482854328AA791373SMTBADA000947SKSchistosoma Lambda Zap II


Date: 2:41:26 on Thu 23 Nov 117.