EST 1513049 is a singleton


Sequence

>1513049 (1 EST) Length=218 GGCTTTCGTCAGTTTCTTCCAAGAAGATCAACCAGTTGTTGAAACACTCATGTAGAAGTTCTTCACAAATGCCCAATCCT TACCGTAACCCGCTTAGAACGCAAACCAATCCTGTTGGGTATATTACATTTACTGTTTTTGTTTTACCGATGTTATGGAT TATTCACGACAAAGCCTATGATATAGATCAAAAACCTCGACGTTGAAATGACAACTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1513049: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130492854329AA791374SMTBADA000948SKSchistosoma Lambda Zap II


Date: 6:7:49 on Sun 19 Nov 117.