EST 1513050 is a singleton


Sequence

>1513050 (1 EST) Length=210 CTATGCGTAAAGATACTATTATGCCTCAAAACTGACATGGAAAGAACTATACTGTAAANNCCCAGTTATGCTGAGGTAAA AGCTAAAAACCTTACGAAACGAAAAGTAAATCGAGGAAAGTGAAGAGAATAACCCAGTGAAACGGTGTAATATTACCGGG AGTATGTACTTAGCCGTCGTTACTGATATCCTAACATATTACGTACTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1513050: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15130502854330AA791375SMTBADA000958SKSchistosoma Lambda Zap II


Date: 6:6:18 on Sun 19 Nov 117.