EST 1523370 is a singleton


Sequence

>1523370 (1 EST) Length=161 GCAAAATGCTGGCTCGAATGGGATATCGTGAAGGACAAGGTCTAGGTAGAGAAAGTCAAGGAATGTCTACTGCATTAGTT GTTGAAAAAACTAGTCGACGTGGTGGCAAAATAATTCACGAAAAAGACCAACAACGTCAACAATCCGCACCAATGCTTCG T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1523370: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233702870772AA801600SMTBADA000725SKSchistosoma Lambda Zap II


Date: 2:35:16 on Mon 20 Nov 117.