EST 1523372 is a singleton


Sequence

>1523372 (1 EST) Length=164 ATTTTTAAAGCATCCACGATCTTCTAGTCGTACCTCTCACTATAGGCCTTCATTTGTNTCGCCGCTTACTGGTATACTTT CAGTTTAACGGTCTCCTCATGGCATAATTTTATCTTTTCTCGGCTTACGTTAAACACTAGTCAAACAAAGAGTTTCTATC CGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1523372: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233722870774AA801602SMTBADA000731SKSchistosoma Lambda Zap II


Date: 12:38:23 on Tue 21 Nov 117.