EST 1523373 is a singleton


Sequence

>1523373 (1 EST) Length=164 AGTAAAAATGTGTAGGTGCTAGAAGATCAGCATTTGGAGTGATATCCGGAAGTGAAACAAGCGGCGAATGACCATATGAA AAGTCAAATTGCAGAGGAGTACCGTATTAAAATAGAAAAAGAGTTGATCGAATTTGTGTTCAGGTTTGGTTTGCCCAAAA CCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1523373: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233732870775AA801603SMTBADA000732SKSchistosoma Lambda Zap II


Date: 6:54:32 on Mon 20 Nov 117.