EST 1523374 is a singleton


Sequence

>1523374 (1 EST) Length=152 CTTTCATCAGCCATAATTGCCATGCTCCATTGTCAAAATCACACATATATATATGATATGAACCAACCTATTTTGTTTAA ATATGATCACACAAATAAGAGGAATTTTCAAAATATGTAGGGGATCTACCGTTGGTAATCACAATTTGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233742870776AA801604SMTBADA000734SKSchistosoma Lambda Zap II


Date: 2:2:14 on Sat 18 Nov 117.