EST 1523377 is a singleton


Sequence

>1523377 (1 EST) Length=128 ATATAAACAGGATTTTGAGGCAATATATAGAAAATAAAAGGTATACAATTATCATAATGTGTAATAAAATTTATTGATTC TTTGTTTATCGAATATGTTTACAAATATTATCGCGATTTATTTCTAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523377: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233772870779AA801607SMTBADA000760SKSchistosoma Lambda Zap II


Date: 19:35:28 on Fri 17 Nov 117.