EST 1523378 is a singleton


Sequence

>1523378 (1 EST) Length=150 TCAATCATTTCTGATTCTTTTGCCATTTCTTTATCTCTTTGAATTTGTGCTTTCCCTCTTCATGTTTGTTTCAGCGTCAC CACTATACACTCAAATCTTCTGAGTTTTCATTTTACTTATGTTTCATTGTAAAAAAGCAAACCTTCCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1523378: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233782870780AA801608SMTBADA000765SKSchistosoma Lambda Zap II


Date: 11:49:6 on Thu 23 Nov 117.