EST 1523379 is a singleton


Sequence

>1523379 (1 EST) Length=167 ATGCAGTATTACCGGTGGTCCATTAACATCAGAATATAAACTGACACAATTTCATTTACATTGGGGATCTGGTAATAACT GGGGCTCTGAGCATATGATCAATGGGATAAGTTGTCCTGCTGAACTACATTGTGTATTTATTAATACTAAATAGCTACAG GAGACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1523379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233792870781AA801609SMTBADA000767SKSchistosoma Lambda Zap II


Date: 19:19:44 on Thu 23 Nov 117.