EST 1523382 is a singleton


Sequence

>1523382 (1 EST) Length=172 ATTACCACATTCAAATGTTAATAATCCCTGTCTTGTTGTTTTTATAATATTTGTACTGAGAATTGTTTAGCTCTGTTTTC CGATACTTCAATGTGATGCCTTTTTATTTTATAAATTTTCATTATCTAGCTTATTGTATGGTGTTAGTTTGATTTCGTAC ATGTTACTATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523382: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233822870784AA801612SMTBADA000772SKSchistosoma Lambda Zap II


Date: 19:32:39 on Mon 20 Nov 117.