EST 1523385 is a singleton


Sequence

>1523385 (1 EST) Length=136 ACGGAATGATAATCCCAGTAGTAATCATGGACTCAGAGACGAGTTTATGTAGCTGAGTAGCTCTCAGTATACCTGATTTC CCGAAAGGATCTCGATTTACGATAGTTATCATTCTATTATTTTGTTAATTAGTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523385: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233852870787AA801615SMTBADA000780SKSchistosoma Lambda Zap II


Date: 23:28:33 on Sun 19 Nov 117.