EST 1523386 is a singleton


Sequence

>1523386 (1 EST) Length=181 GCGCACAAAAGTGCATTTTAGAGATAGATCAAGTANATCTGTNGCGAAAATATATCACCGAGGTCATGATCTTTCCTGCT CNTAATGGACAAAAGACCATAANNNTACACGAAACGTATAAATGGCCGCATCNNNNCATGTTGAACAGTCTCGTACTACA TACGATATATATAAGTGATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1523386: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233862870788AA801616SMTBADA000815SKSchistosoma Lambda Zap II


Date: 0:1:39 on Sun 19 Nov 117.