EST 1523393 is a singleton


Sequence

>1523393 (1 EST) Length=180 CCCAACTGTTTAATGTGGATTATTCATTCTCCGTGAAAATTACTCTACATATATTCGTTTAGTGCAATCAGAATAGTTTT ATGCCAATTACCCAAGTCGAAAAAATCGTAAGAAACCATTCCAATAACTACAATCACAATAACAAGAATAATCCTGTTAA ACAAATTACTACCACAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1523393: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233932870795AA801587SMTBADA000882SKSchistosoma Lambda Zap II


Date: 5:14:7 on Tue 21 Nov 117.