EST 1523394 is a singleton


Sequence

>1523394 (1 EST) Length=158 TTGGTTATAGAGCTTTTTCACTTTAATCATTATATTCTCCAACAAAGGTACTTCGTTCGTTCAATTATCTAGATCTATAT CTTTANNNTTCTCAAATCGATCCGATTCATATACAAACATGACTGCCAATCAGCTCGTCATCTTACCAGGATCATAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1523394: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233942870796AA801588SMTBADA000886SKSchistosoma Lambda Zap II


Date: 18:30:34 on Sat 18 Nov 117.