EST 1523395 is a singleton


Sequence

>1523395 (1 EST) Length=167 TCTCCCATAGCAACAACAACAACAACGATAGCAACCAATAAATCAATAAAAAAATAGATTAAAACGAACAGCAATAACAA CAAAATATAAACATGATTATTCTATTTTATCTTTAAAATGGTTGTTATTCATATTATTACTATGGTTATTATTATTATTA TTACCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1523395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233952870797AA801589SMTBADA000900SKSchistosoma Lambda Zap II


Date: 9:41:33 on Fri 24 Nov 117.