EST 1523398 is a singleton


Sequence

>1523398 (1 EST) Length=157 CGATAAAGTAGATAACTATTTCACTTATATATTCAAAAAATAAAATAAGCAGATCAAAAACAAGATAAGTTACCAATTAT TTTGACTCATTTATCTAAACATAACAATCATTCTCGATTAAGACACTTCAAGAAAACGAGAACTTATAATTAAACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523398: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15233982870800AA801592SMTBADA000911SKSchistosoma Lambda Zap II


Date: 17:59:48 on Fri 17 Nov 117.