EST 1523403 is a singleton


Sequence

>1523403 (1 EST) Length=186 CTTTTGTACGAACCATGTATAGAAATCAATCTATTATTTTAAATCGAATAAATGACTGATATCATAACTCATTTCATTAG TTGGAATTTGTCTTTGTTTTTATGTTTAGTGTGCTTGATTCTATTGCCTATATATTGACTGACGTATATAATTAGCTTAT ATTTATGTCTCAGTTCTCACATAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1523403: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15234032870805AA801597SMTBADA000922SKSchistosoma Lambda Zap II


Date: 16:46:19 on Sat 18 Nov 117.