EST 1525941 is a singleton


Sequence

>1525941 (1 EST) Length=180 TTCGTCAATTCTCGAATAAAGCCTTGGGTAGATAAGAAGATTGTAAGCTATATCGGAGAAGCCTGAAGCCACATTATCCA GTTTCATATGCGATCAACTACTACATCACAATCCACCAGAACGTATTCTTGCTGACATTGCCATGGTTTTAGATGAAGAG GCAGAAGTATTTCGAAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1525941: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15259412873398AA804150SMTBADA000928SKSchistosoma Lambda Zap II


Date: 9:3:21 on Tue 21 Nov 117.